Skip to main content

Table 2 Primer and probe sequences for analyses of L. spp in Real Time PCR

From: Nutraceutical effects of table green olives: a pilot study with Nocellara del Belice olives

  Oligonucleotide sequence 5′-3′
Primer Forward GAGGCAGCAGTAGGGAATCTTC
Primer Reverse GGCCAGTTACTACCTCTATCCTTCTTC
Probe FAM-ATGGAGCAACGCCGC-QUENCER