Skip to main content

Table 1 Forward and reverse primer sequences used on the quantitative PCR and RT-PCR assays

From: Decline of FOXN1 gene expression in human thymus correlates with age: possible epigenetic regulation

Target Sequence forward (5'-3') Sequence reverse (5'-3') Amplicon size (pb) Reference
FOXN1 (NM_003593.2) TCCCTCACTCACTGACTTCG (1628–1647) GTGGCATCGAAGATGATGTC (1746–1727) 119 [72]
DLL1 (NM_005618.3) TGCAACCAGGACCTGAACTA (1323–1342) CTCCGTTCTTACAAGGGCTG (1491–1472) 163 *
DLL4 (NM_019074.3) CAGAGTGTCGGATATCAGCG (2288–2307) CTCCTGCCTTATACCTCCGT (2402–2383) 115 *
  1. HPRT-1 (hypoxanthine phosphoribosyltransferase 1), TRFC (transferrin receptor) and RPL13A (ribosomal protein L13a) were used as control housekeeping genes. (*)Designed using the software Primer3 [37]. FOXN1: forkhead box N1; DLL1: Delta-like 1 (Drosophila); DLL4: Delta-like (Drosophila) 4; WNT-4: wingless-type MMTV integration site family, member 4.