TBX21, the Master regulator of the type 1 immune response, overexpresses in the leukocytes of peripheral blood in patients with late-onset Alzheimer’s disease

Table 7 Designed primer sequences for rs41515744 [C > T] and rs17244587 [G > A]

Primer (5’>3’)					Product size for:
rs41515744 [C>T]			GC (%)	Tm (^°C)	C allele	T allele	Full product
Outer	Forward	5’- AATTGTCAGTACCATGCCTCAATCCCAG -3’	46	60.5	185 bp	297 bp	424 bp
Outer	Reverse	5’- TGTAATCCCAACTACTCAGGAGGCTG -3’	49	59.7
Inner	Forward _{(T allele)}	5’- CATGTTGCTTAATCATGCACTACTCCGCT -3’	44	60.7
Inner	Reverse _{(C allele)}	5’- AACAAGTTTTTGGAAACTAGAAAGCAGCCG -3’	41	60
rs17244587 [G>A]			GC (%)	Tm (^°C)	G allele	A allele	Full product
Outer	Forward	5’- TTCTCCTTTTGATAAGGAAGCTGAAGGAC -3’	44	58.4	281 bp	384 bp	611 bp
Outer	Reverse	5’- TTTTCTCTGATCCCCACTGTGTTTGAGC -3’	46.4	60
Inner	Forward _{(G allele)}	5’- GGAGAAAAGAAGACAAGAAAGTCTTTGG -3’	41	58.1
Inner	Reverse _{(A allele)}	5’- CACTAGATGCAAAAAGCTCCTTCAGGT -3’	44.4	59

ISSN: 1742-4933